Search Tenders
Filters
Reset All
Tender Status
T18 Ref No
All States
All Cities
All Agencies
Tender ID
Due Date
Tender Value
Tender Source (GeM, Cppp & Others)
Tender Type

19Latest Pcr primer Tenders List

Latest Pcr primer Tenders in India – Verified Leads & Real-Time Insights by Tender18

Finding the right Pcr primer tenders in India’s competitive e-procurement ecosystem requires more than just access—it demands accurate data, real-time monitoring, and expert analysis.

At Tender18 Infotech Private Limited, we bring deep industry experience in government procurement to help businesses identify, evaluate, and win Pcr primer tenders efficiently. With a centralized platform aggregating 1100+ live tenders, we provide a single, trusted source for opportunities from central, state, and PSU departments.


Real-Time Pcr primer Tender Intelligence & Monitoring

Our advanced dashboard delivers actionable insights and structured tender data, enabling you to make faster and smarter bidding decisions.

We categorize Pcr primer tenders into:

  • Supply Tenders – BOQs and specifications sourced from GeM and PSUs
  • Service Tenders – NITs and scope of work from CPPP and state portals
  • EPC Projects – Large-scale infrastructure tenders with financial and design data

✔ This structured approach ensures complete transparency and deeper bid analysis before submission.


Comprehensive Sources of Pcr primer Tenders

Tender18 acts as a centralized gateway by aggregating tenders from trusted and official sources:

  • Central Government Portals – CPPP, NIC, and Government e-Marketplace (GeM)
  • Railways & Transport – IREPS and Metro Rail projects
  • Power & Energy PSUs – NTPC, ONGC, NHPC, PowerGrid
  • Defense & Strategic Sectors – MES and DRDO tenders
  • State e-Procurement Portals – Gujarat, Maharashtra, Tamil Nadu, UP, and more

✔ Every listing is verified and regularly updated to maintain data accuracy and trust.


Step-by-Step Guide to Participate in Pcr primer Tenders

1. Eligibility & Prequalification

Before bidding, ensure compliance with:

  • Financial turnover requirements (30–50% of tender value)
  • Past experience (2–3 similar projects)
  • Valid solvency certificate

2. Mandatory Documentation Checklist

Prepare the following to avoid disqualification:

  • Digital Signature Certificate (Class 3 DSC)
  • GST, PAN, MSME/Udyam registration
  • EMD (Earnest Money Deposit) or exemption proof
  • Technical bid with execution methodology

3. BOQ Analysis & Financial Bidding

The BOQ (Bill of Quantities) is the most critical component:

  • Analyze item-wise pricing
  • Ensure competitive yet sustainable quotes
  • Avoid underbidding risks (L1 pressure)

✔ Expert analysis can significantly improve your bid success ratio.


Why Tender18 is a Trusted Platform for Pcr primer Tenders

✔ Proven Expertise in Government Procurement

We combine industry knowledge with practical bidding experience.

✔ Verified & Reliable Data

All Pcr primer tenders are sourced from official portals and cross-checked for accuracy.

✔ Advanced Filtering Tools

Filter tenders by value, EMD, location, and category for precise targeting.

✔ Corrigendum & Update Tracking

Get instant alerts on deadline changes and specification updates.

✔ Historical Data Insights

Analyze past tender results to understand pricing trends and competition.

✔ End-to-End Bidding Support

From discovery to submission, including GeM onboarding and strategy.


Growth of Pcr primer Sector in 2026

With the Government of India focusing on digital procurement and infrastructure expansion, the Pcr primer sector has seen significant growth in e-tendering opportunities.

The rise of GeM-based procurement models like:

  • L1 Purchase
  • Direct Procurement
  • MSME-friendly policies

…has made it easier for startups and SMEs to participate and win contracts


Frequently Asked Questions (SEO Optimized)

How can I get daily Pcr primer tender alerts?

You can register on Tender18 and select your preferred category. You will receive daily email alerts with all new Pcr primer tenders.

Is EMD mandatory for all Pcr primer tenders?

No, MSME and Udyam-registered businesses may get exemptions. Always check the NIT for specific conditions.

What is the difference between a Pcr primer work tender and supply tender?

A supply tender involves delivering goods, while a work tender includes execution, labor, and project completion.

Can I access private Pcr primer tenders on Tender18?

Yes, we also track major private sector and EPC tenders along with government opportunities.


Get Expert Support for Pcr primer Tenders

Tender18 is more than a listing platform—we are your strategic partner in winning tenders.

Our services include:

  • Tender discovery & analysis
  • Documentation support
  • Bid strategy & submission
  • GeM registration & OEM onboarding

📞 Call / WhatsApp: +91 7069661818
🌐 Website: www.tender18.com

Due Date
T18 Ref No : 16954521
Source : GEM Tenders
LIVE TENDER
T18 Ref No : 16760653
Location : gwalior , madhya pradesh
Source : GEM Tenders
LIVE TENDER
tender for primers probes and pcr kit fam 5 ttccgaatgaatgttttcaatggcc 3 bhq1 , 5 gatagtttttttcattactatctttaacat 3 , 5 ggctagatgtttctacggatttc 3 , fam 5 tgaatgaatgcgatactgtatgtgtggg 3 bhq1 , 5 acgtgttaaacaatgggtgatg 3 , 5 aacatttccatgaatcgtagtcc 3 , joe 5 aagtcatctactacatagaccatgatcaaccaa 3 bhq1 , 5 ggtaggttcatgttggaaaatatc 3 , 5 aagatgttattagtggtattagagagaaat 3 , tamra 5 caatgtgtccgctgtttccgttaataat 3 bhq2 , 5 ggcaatggattcagggatatac 3 , 5 atttatgaataatccgccagttac 3 , 5 tgaaccactgacggtggtgggagtcatgctc 3 , 5 gggttccattccacttcaccgcaccactctg 3 , 5 uaauuucuacuaaguguagauuccuccucaugaugguacugg 3 , 5 aaccccuaccaacuggucgggguuugaaacguacuacagauag agacaccag 3 , 5 aaccccuaccaacuggucgggguuugaaacuuuaacauauagu gaaccgcca 3 , 5 aaccccuaccaacuggucgggguuugaaacuucauuuuaccgu caccaccacg 3 , 5 ttgcatatacgatacaaggc 3 , 5 gctggtgtctctatctgtag 3 , 5 acgatacaaggctgttagag 3 , 5 ggcggttcactatatgttaaag 3 , 5 gcatatacgatacaaggctgtt 3 , 5 cttggcgtgtttattctacag 3 , 5 tacaaggctgttagagagataa 3 , 5 gtggtggtgacggtaaa 3 , 5 tacgatacaaggctgttaga 3 , 5 gctgcaatattgttaacgtg 3 , realstar orthopoxvirus pcr kit 1.0 , flexstar monkeypox virus pcr detection mix 1.5, primers probes and pcr kit, fam 5 ttccgaatgaatgttttcaatggcc 3 bhq1, 5 gatagtttttttcattactatctttaacat 3, 5 ggctagatgtttctacggatttc 3, fam 5 tgaatgaatgcgatactgtatgtgtggg 3 bhq1, 5 acgtgttaaacaatgggtgatg 3, 5 aacatttccatgaatcgtagtcc 3, joe 5 aagtcatctactacatagaccatgatcaaccaa 3 bhq1, 5 ggtaggttcatgttggaaaatatc 3, 5 aagatgttattagtggtattagagagaaat 3, tamra 5 caatgtgtccgctgtttccgttaataat 3 bhq2, 5 ggcaatggattcagggatatac 3, 5 atttatgaataatccgccagttac 3, 5 tgaaccactgacggtggtgggagtcatgctc 3, 5 gggttccattccacttcaccgcaccactctg 3, 5 uaauuucuacuaaguguagauuccuccucaugaugguacugg 3, 5 aaccccuaccaacuggucgggguuugaaacguacuacagauagagacaccag 3, 5 aaccccuaccaacuggucgggguuugaaacuuuaacauauagugaaccgcca 3, 5 aaccccuaccaacuggucgggguuugaaacuucauuuuaccgucaccaccacg 3, 5 ttgcatatacgatacaaggc 3, 5 gctggtgtctctatctgtag 3, 5 acgatacaaggctgttagag 3, 5 ggcggttcactatatgttaaag 3, 5 gcatatacgatacaaggctgtt 3, 5 cttggcgtgtttattctacag 3, 5 tacaaggctgttagagagataa 3, 5 gtggtggtgacggtaaa 3, 5 tacgatacaaggctgttaga 3, 5 gctgcaatattgttaacgtg 3, realstar orthopoxvirus pcr kit 1.0, flexstar monkeypox virus pcr detection mix 1.5

Unlock Full Tender Access

Start Free Trial to download documents before deadline

T18 Ref No : 16872385
Location : mumbai , maharashtra
Source : GEM Tenders
T18 Ref No : 16034657
Location : pune , maharashtra
T18 Ref No : 16342061
Location : mumbai , maharashtra
Source : GEM Tenders

Unlock Full Tender Access

Start Free Trial to download documents before deadline

T18 Ref No : 16104725
Source : GEM Tenders

Unlock Full Tender Access

Start Free Trial to download documents before deadline

T18 Ref No : 16583100
Location : kamrup , assam
Source : GEM Tenders
corrigendum tender for agar , ammonium ceric nitrate , absolute alcohol gr grade , ampicillin trihydrate , benomyl , chloramphenical , chloroform , chlorotetracycline hydrochloride , cycloheximide extra pure 94 percent , corn meal agar , cotton blue , chlorotetracycline , carbendazim , dipotassium hydrogen phosphate , distilled water , dextrose , fast green , ethyl alcohol , glucose , glycerol , lactophenol , magnesium sulphate , metalaxyl , mycological peptone , methnol , parafilm wax , ph indicator paper , potassium chloride , potassium permanganate , penta nitro benzene , peptone , potato dextrose agar , rose bengal agar , safranin , sodium chloride , streptomycin sulphate , tetracycline plus streptomycin , triton x 100 , thiobenzimidazole , nutrient agar for bacterial culture , yeast extract , tergitol , acrylamide bis acrylamide solution 30 percent 29isto1 or 37point 5isto1 , tris base , tris hcl , glycine , sds sodium dodecyl sulfate , ammonium persulfate aps , temed , hydrochloric acid hcl , sodium hydroxide naoh , tris-glycine-sds running buffer 10x , laemmli sample buffer 2x or 4x , reducing agent dtt , b mercaptoethanol alternative , bromophenol blue , agarose , 50x tae buffer , gelred , dna loading dye 5 ml , 100 bp dna ladder , bacterial dna extraction kit , pcr master mix , universal bacterial primers if performing pcr identification , nuclease free water, agar for microbiology, 100 gm, 100 gm, 500 ml, 5 gm, 500 gm, 50 ml, 5ltr, 250 gm, 200 gm, 100 ml, 1 gm, 100 leaves, 125 ml, 10 gm, 25 gm, 100 ml, 5 ml, 25 ml, 1 ml, 200 lanes, 100 preparations, 2 x 5 ml, 50 nmol

Every year, central and state government departments release thousands of high-value contracts specifically dedicated to Pcr Primer. Whether it involves bulk material supply, executing specialized operational services, or end-to-end turnkey project execution, the demand for capable vendors in the Pcr Primer sector is massive.

At Tender18, we help businesses cut through the noise and exclusively target the exact work categories they specialize in. Instead of browsing through generic procurement sites, our platform isolates high-potential opportunities that match your specific industry capabilities.

Work Dynamics in the Pcr Primer Sector

Government requirements for this specific vertical generally fall into distinct procurement patterns:

  • Product & Material Supply: Tenders focused strictly on sourcing, testing, and delivering high-quality items that meet the exact technical specifications of the buyer.
  • Service Level Agreements (SLAs): Long-term hiring of expert agencies for routine maintenance, manpower deployment, or continuous operational management.
  • Execution & Turnkey Projects: Comprehensive contracts where the bidder is responsible for everything from raw material procurement to final site installation and testing.

By focusing purely on your core strength in Pcr Primer, you can build a highly profitable and stable pipeline of government clients.

Stop wasting time filtering through irrelevant notices. Our Pcr Primer Tender Information Service is engineered for precision. We track exact product codes, service names, and specialized work terms across all government portals nationwide. When a buyer publishes a requirement that matches your specific business profile, our system alerts you instantly.

Deep Technical Insights & Documentation For Pcr Primer Tenders

Bidding for specific works requires studying strict technical parameters. We provide immediate access to the core documents you need to evaluate the project:

  • Detailed Specifications & Drawings: Download the exact engineering guidelines, material testing standards, and quality benchmarks demanded by the buyer for Pcr Primer.
  • Financial BOQ Spreadsheets: Access the official blank pricing formats where you need to input your unit rates, tax configurations, and total bid value.
  • Real-Time Technical Amendments: If the buying department changes the product specifications, alters the service scope, or shifts the delivery timeline, we instantly update the parent file so you are never caught off-guard.

Winning a contract for Pcr Primer depends entirely on how perfectly your technical capabilities match the buyer’s demands. Even if you have the best product or service, a poorly formatted document or a missing compliance certificate will lead to instant technical rejection. Tender18’s Tender Bidding Service eliminates this risk by taking complete ownership of your digital submission.

Flawless Compliance & Portal Execution For Pcr Primer Tenders

Under this service, Tender18 assigns a Dedicated Experienced Technical Person to your profile. This expert handles the heavy lifting of the entire bidding cycle:

  • Capability Mapping: We thoroughly cross-check your past completion certificates, ISO standard proofs, and financial turnover against the strict eligibility criteria required for Pcr Primer bids.
  • Secure System Integration: Our technical desk seamlessly links your Class III Digital Signature Certificate (DSC) with the required e-procurement servers to securely encrypt your technical and financial envelopes.
  • Error-Free Financial Uploads: We audit your quoted BOQ pricing sheets for any formula or formatting errors before the final upload, ensuring your bid is successfully locked before the portal's closing hours.

Government buyers are aggressively using the Government e-Marketplace (GeM) for the direct procurement of Pcr Primer. If your business profile is not accurately mapped on this portal, you remain practically invisible to these purchasing officers. Recognized as a trusted and expert GeM consultant, Tender18 offers specialized support to build, optimize, and maintain a highly visible vendor account for your business.

With an industry-leading support success ratio of over 95%, we handle the complex marketplace compliance so you can focus entirely on executing your orders

Expert Profile Management & Catalogue

Our dedicated consultants ensure your GeM presence is structurally perfect:

  • Precise Catalogue Listing: We upload and categorize your specific offerings under the exact search terms and parameters used by government buyers looking for Pcr Primer, ensuring maximum search visibility.
  • OEM Dashboard & Assessment: For original manufacturers and creators, we guide you through the mandatory Quality Council of India (QCI) vendor assessments to successfully unlock your official OEM panel.
  • Profile Compliance & Caution Money: We manage your statutory documentation, brand approvals, and caution money limits to keep your account immune from technical suspensions.

Strategic Live Bid Participation

Beyond setup, we actively drive your market participation. Our team expertly handles the digital paperwork and rate configurations for GeM Custom Bids and Reverse Auctions (RA) related to Pcr Primer, maximizing your chances of securing L1 status.

1.

How do I find government contracts exclusively matching my work in Pcr Primer?

The easiest way is through the Tender18 platform. Instead of searching department by department, our system uses advanced keyword matching to gather all live supply, service, and execution tenders related directly to your core business in one place.

2.

Do I need specific testing or quality certificates to apply for these contracts?

It heavily depends on the nature of the work. For supply contracts, buyers often ask for ISO certifications, BIS marks, or specific lab testing reports. For service contracts, they may ask for labor licenses or past performance certificates (work orders).

3.

What is a BOQ and why is it important for my bid?

The Bill of Quantities (BOQ) is the official financial Excel sheet where you enter your competitive prices. Any mistake in this file—like adding extra rows, changing formulas, or saving it in the wrong format—will cause the portal server to reject your entire bid.

4.

Are samples required to be submitted physically before the digital bid opens?

For many product-based Pcr Primer tenders, buying departments do ask bidders to submit physical samples to their office before the digital technical evaluation date. This requirement is always clearly mentioned in the official NIT document.

5.

How does the Dedicated Tender Expert from Tender18 help me?

Our assigned expert manages your total portal compliance. They extract the hidden rules from long tender PDFs, create a precise document checklist for your team, map your digital signature, and securely upload your technical and financial files onto the government servers.

6.

What is the role of a Digital Signature Certificate (DSC)?

A Class III DSC is a secure USB device that contains your digital identity. You cannot upload a bid without it. It is used to securely encrypt and lock your sensitive price data and technical documents so no one can view them before the official opening date.

7.

As an MSME, can I get financial benefits when bidding for Pcr Primer?

Yes, the government strongly supports MSMEs. By uploading a valid Udyam Registration Certificate in the technical envelope, small businesses are frequently exempted from paying the initial Tender Document Fee and the Earnest Money Deposit (EMD).

8.

Why should I list my services or products on GeM for this category?

GeM is now the primary digital marketplace for all government agencies. If you are properly cataloged for Pcr Primer, officers can view your profile and generate direct purchase orders or invite you to participate in exclusive Custom Bids.

9.

What makes Tender18 a reliable GeM support partner?

As a highly trusted and expert GeM consultant, Tender18 holds a proven support success ratio of over 95%. From flawless profile creation and complex catalogue mapping to OEM panel approvals and live Reverse Auction (RA) support, we handle it all seamlessly.

10.

What does "L1" mean in these government contracts?

"L1" stands for "Lowest Bidder 1". In government procurement, after all technical envelopes are approved, the financial sheets (BOQs) are opened. The bidder who has quoted the lowest compliant price for Pcr Primer is declared L1 and is generally awarded the contract