tender for cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt, nucleotide sequence, ea1f, ea1r, ea2fa, ea2r, ea2fb, wr1f, wr1r, wr2f, wr2r, bjwrr1-ra, bjwwr1-rb

Latest Tender Detail from indian council of agricultural research ICAR for the tender for cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt, nucleotide sequence, ea1f, ea1r, ea2fa, ea2r, ea2fb, wr1f, wr1r, wr2f, wr2r, bjwrr1-ra, bjwwr1-rb in kumher, rajasthan,. Reference number 15807263. Don't miss out on this chance to be part of a significant project. Register for free today to access the complete tender details and download the necessary documents. Seize the opportunity with Tender 18!

T18 Ref No.
15807263
Tender ID
GEM/2026/B/7664782
City
Tender Related Keywords
-
Description :
total quantity = 291 ----- document required from seller = experience criteria,past performance,bidder turnover,certificate (requested in atc),oem authorization certificate ----- evaluation method = total value wise evaluation
T18 Ref No.
15807263
Tender ID
GEM/2026/B/7664782
Tender Value
Refer Document
Tender EMD
Refer Document
Tender Fee
Refer Document
City
Published Date
Jun 15, 2026
Due Date
Jul 06, 2026
Tender Opening Date
Jul 06, 2026
Tender Related Keywords
-
Description :
total quantity = 291 ----- document required from seller = experience criteria,past performance,bidder turnover,certificate (requested in atc),oem authorization certificate ----- evaluation method = total value wise evaluation

Get Complete Tender Documents to Participate

Tender NoticeBOQEligibilityEMD DetailsImportant Dates
We take all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.

Browse GeM Portal Tenders

This Government Tender has been Published  by Indian Council Of Agricultural Research ICAR for work related to in Kumher, Rajasthan. The Tender work is tender for cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt, nucleotide sequence, ea1f, ea1r, ea2fa, ea2r, ea2fb, wr1f, wr1r, wr2f, wr2r, bjwrr1-ra, bjwwr1-rb. Tender18 Provide this type Government Tender Information on daily basis.


This tender invites eligible contractors, suppliers, manufacturers, consultants, Startups, Msmes, traders and service providers to submit bids for the specified project, supply, service, or work requirement.


Before applying, interested bidders should review the tender scope, eligibility criteria, estimated contract value, important dates, technical requirements, reqired docuent list for bidder and bid submission instructions as per provided in the official tender documents. 


This Verified Information Provide By Tender18 in this page so Bidder Can Easiy  Understanding tender  requirements and bidders can prepare a compliant and competitive tender proposal.

To participate in the tender for cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt, nucleotide sequence, ea1f, ea1r, ea2fa, ea2r, ea2fb, wr1f, wr1r, wr2f, wr2r, bjwrr1-ra, bjwwr1-rb, bidders should first download and review all available tender documents. These documents generally include the Notice Inviting Tender (NIT), Bill of Quantities (BOQ), technical specifications, eligibility criteria, scope of work, and bid submission instructions.


Tender Governemnt Authorities like Indian Council Of Agricultural Research ICAR usually publish these documents on their official eProcurement portals, departmental tender portals, the GeM Tender Portal, or other government procurement platforms or on newspapre. Finding and accessing the correct tender documents across multiple portals can sometimes be time-consuming for bidders. 


To make the process easier, Tender18 provides quick access to the available tender documents related to this Kumher , Rajasthan tender on a single page. Businesses involved in related products, services, or works can conveniently download the relevant documents and review the tender requirements without spending time searching across different procurement portals.

The tender for cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt, nucleotide sequence, ea1f, ea1r, ea2fa, ea2r, ea2fb, wr1f, wr1r, wr2f, wr2r, bjwrr1-ra, bjwwr1-rb from Kumher, Rajasthan may be relevant for contractors, suppliers, vendors, manufacturers, consultants, service providers, startups, MSMEs, and other organizations involved in related products, services, or works. However, eligibility to participate depends on the qualification criteria specified by Indian Council Of Agricultural Research ICAR in the official tender documents.

Before submitting a bid, interested applicants should carefully review the eligibility conditions, technical requirements, financial criteria, work experience requirements, annual turnover conditions, registrations, certifications, and any other supporting documents required by the tendering authority. The detailed qualification requirements and bidder eligibility criteria are available in the tender notice and related documents provided on this page. 

Ensuring compliance with all eligibility and qualification requirements before bid submission can help bidders avoid disqualification and improve their chances of successful participation in the tender process.

Tende18 provides comprehensive tender bidding services, including a complete tender summary along with a detailed analysis of the Tender Qualification and Eligibility Criteria.

Interested in participating in the tender for cgg aag act tgc tct tct ta , gtt att tgg tgc ata taa tac ata , tca gat ccc aga aga ctt gtt aat , atg tat ata tgt gta tga atg tag tac tcg , gat ctg gat gtt cat aag g , gaggtggaagagtacggttgtg , cctcacaatttcagtcaacatcgt , gccacctcctagatgtggtcata , gtccatccaggtgtttcacg , ggcatagtattccctagaagagagataac , tgttgattcttagaatggtaaatcacag , ttgaaaatcacatgtatacatatggctt, nucleotide sequence, ea1f, ea1r, ea2fa, ea2r, ea2fb, wr1f, wr1r, wr2f, wr2r, bjwrr1-ra, bjwwr1-rb issued by Indian Council Of Agricultural Research ICAR for related work in Kumher, Rajasthan? TENDER18 provides complete assistance to help businesses understand tender requirements, access tender documents, review eligibility criteria, qualification requirements, important dates, and bid submission guidelines associated with this tender.

Our Tender18 Expert Technical team can assist with vendor and GeM registration on the relevant departmental, eProcurement, GeM, or government tender portal, preparation of technical and financial bid documents, compliance with qualification criteria, document verification, and complete online tender submission support. Whether you are a contractor, supplier, manufacturer, consultant, startup, or MSME working in the field of , Tender18 can help simplify the tender participation process and support you throughout every stage of bidding for this tender. so that tender18 is one the top leading tender consultant in Inda.

1.

Whom should I contact if I have further queries about the Tender scope?

You can fill out the integrated inquiry form below on this detail page to share your company profile. Our consultancy desk will review your query regarding parameters and guide you on how to coordinate efficiently with the procurement team of Indian Council Of Agricultural Research ICAR

2.

How can Tender18 assist my business in winning this government contract?

Tender18 provides end-to-end professional bidding support and documentation advisory for Tender For Cgg Aag Act Tgc Tct Tct Ta , Gtt Att Tgg Tgc Ata Taa Tac Ata , Tca Gat Ccc Aga Aga Ctt Gtt Aat , Atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg , Gat Ctg Gat Gtt Cat Aag G , Gaggtggaagagtacggttgtg , Cctcacaatttcagtcaacatcgt , Gccacctcctagatgtggtcata , Gtccatccaggtgtttcacg , Ggcatagtattccctagaagagagataac , Tgttgattcttagaatggtaaatcacag , Ttgaaaatcacatgtatacatatggctt, Nucleotide Sequence, Ea1f, Ea1r, Ea2fa, Ea2r, Ea2fb, Wr1f, Wr1r, Wr2f, Wr2r, Bjwrr1-ra, Bjwwr1-rb . Our senior analysts help you decode the complete project guidelines, manage accurate costing sheets, and complete error-free submissions on the official platform used by Indian Council Of Agricultural Research ICAR.

3.

What are the main reasons for a technical tender rejection?

Most online bids face rejection during the initial evaluation round due to avoidable errors like uploading blurred document scans, submitting expired DSCs, or missing critical experience papers required for Tender For Cgg Aag Act Tgc Tct Tct Ta , Gtt Att Tgg Tgc Ata Taa Tac Ata , Tca Gat Ccc Aga Aga Ctt Gtt Aat , Atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg , Gat Ctg Gat Gtt Cat Aag G , Gaggtggaagagtacggttgtg , Cctcacaatttcagtcaacatcgt , Gccacctcctagatgtggtcata , Gtccatccaggtgtttcacg , Ggcatagtattccctagaagagagataac , Tgttgattcttagaatggtaaatcacag , Ttgaaaatcacatgtatacatatggctt, Nucleotide Sequence, Ea1f, Ea1r, Ea2fa, Ea2r, Ea2fb, Wr1f, Wr1r, Wr2f, Wr2r, Bjwrr1-ra, Bjwwr1-rb in Rajasthan.

4.

Can contractors located outside the local region participate in this bid?

Eligibility for outstation bidders depends entirely on the terms set inside the document for Tender For Cgg Aag Act Tgc Tct Tct Ta , Gtt Att Tgg Tgc Ata Taa Tac Ata , Tca Gat Ccc Aga Aga Ctt Gtt Aat , Atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg , Gat Ctg Gat Gtt Cat Aag G , Gaggtggaagagtacggttgtg , Cctcacaatttcagtcaacatcgt , Gccacctcctagatgtggtcata , Gtccatccaggtgtttcacg , Ggcatagtattccctagaagagagataac , Tgttgattcttagaatggtaaatcacag , Ttgaaaatcacatgtatacatatggctt, Nucleotide Sequence, Ea1f, Ea1r, Ea2fa, Ea2r, Ea2fb, Wr1f, Wr1r, Wr2f, Wr2r, Bjwrr1-ra, Bjwwr1-rb. While many public sector projects allow national competitive bidding, certain localized works require local offices or specific registration metrics in Kumher.

5.

Do I need an active GeM Portal registration to apply for this work?

If this procurement is routed through the central marketplace, an active GeM Seller ID is mandatory to supply items. Tender18 offers complete assistance for brand cataloging, profile creation, and vendor assessment required officially by Indian Council Of Agricultural Research ICAR

6.

What are the primary legal documents required to submit a valid bid?

To register an eligible bid for these contracts, companies must prepare their core compliance documents. Vendors operating across Rajasthan must ensure they possess a valid GST registration, permanent account number (PAN), and active Class-3 Digital Signature Certificates.

7.

What products or services are required for this active work?

This public procurement cycle is specifically looking for qualified vendors and suppliers who can provide high-quality solutions. The operational execution, delivery, and deployment of these materials must be managed locally within the Kumher region.

8.

Where can I review the estimated cost or budget details for this Tender?

The estimated project cost and budget thresholds can be reviewed directly inside the tender document. Bidders can analyze these qualification files to check if their firm meets the financial capability criteria specified for Tender For Cgg Aag Act Tgc Tct Tct Ta , Gtt Att Tgg Tgc Ata Taa Tac Ata , Tca Gat Ccc Aga Aga Ctt Gtt Aat , Atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg , Gat Ctg Gat Gtt Cat Aag G , Gaggtggaagagtacggttgtg , Cctcacaatttcagtcaacatcgt , Gccacctcctagatgtggtcata , Gtccatccaggtgtttcacg , Ggcatagtattccctagaagagagataac , Tgttgattcttagaatggtaaatcacag , Ttgaaaatcacatgtatacatatggctt, Nucleotide Sequence, Ea1f, Ea1r, Ea2fa, Ea2r, Ea2fb, Wr1f, Wr1r, Wr2f, Wr2r, Bjwrr1-ra, Bjwwr1-rb by Indian Council Of Agricultural Research ICAR

9.

How can I download the official BOQ file for this opportunity?

You can download the commercial Bill of Quantities (BOQ) spreadsheet directly using the secure link provided on this page. The BOQ file contains the item descriptions and rate filling forms officially validated for Tender For Cgg Aag Act Tgc Tct Tct Ta , Gtt Att Tgg Tgc Ata Taa Tac Ata , Tca Gat Ccc Aga Aga Ctt Gtt Aat , Atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg , Gat Ctg Gat Gtt Cat Aag G , Gaggtggaagagtacggttgtg , Cctcacaatttcagtcaacatcgt , Gccacctcctagatgtggtcata , Gtccatccaggtgtttcacg , Ggcatagtattccctagaagagagataac , Tgttgattcttagaatggtaaatcacag , Ttgaaaatcacatgtatacatatggctt, Nucleotide Sequence, Ea1f, Ea1r, Ea2fa, Ea2r, Ea2fb, Wr1f, Wr1r, Wr2f, Wr2r, Bjwrr1-ra, Bjwwr1-rb within the Rajasthan jurisdiction

10.

How can I find the submission closing date for this contract?

The official timeline and deadline details for Tender For Cgg Aag Act Tgc Tct Tct Ta , Gtt Att Tgg Tgc Ata Taa Tac Ata , Tca Gat Ccc Aga Aga Ctt Gtt Aat , Atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg , Gat Ctg Gat Gtt Cat Aag G , Gaggtggaagagtacggttgtg , Cctcacaatttcagtcaacatcgt , Gccacctcctagatgtggtcata , Gtccatccaggtgtttcacg , Ggcatagtattccctagaagagagataac , Tgttgattcttagaatggtaaatcacag , Ttgaaaatcacatgtatacatatggctt, Nucleotide Sequence, Ea1f, Ea1r, Ea2fa, Ea2r, Ea2fb, Wr1f, Wr1r, Wr2f, Wr2r, Bjwrr1-ra, Bjwwr1-rb are available inside the detailed notification files. Bidders planning to target this contract in Kumher should check the official portal schedule early to complete their online technical and financial submission well before the closing hours.

Get Expert Tender Bidding Support

Looking For Complete Tender Bidding Consultancy? Our Technical Experts Will Help You Prepare And Submit Your Tender Successfully.

Call Our Expert: +91 7069661818
Your Information Is 100% Secure & Confidential