tender for p35s probe , tnos probe , fmv probe , plant trnl probe , p35s f primer , p35s r primer , tnos f primer , tnos r primer , fmv f primer , fmv r primer , plant trnl f primer , plant trnl r primer, boq for purchase of oligos primer and probes, fam-caaagatggacccccacccacg-tamra, vic/hex-atgggtttttatgattagagtcccgcaa-tamra, vic-ctgacagcccactcactaatgc-tamra, fam-ttaattccagggtttctctgaatttgaaagtt-tamra, gcctctgccgacagtggt, aagacgtggttggaacgtcttc, catgtaatgcatgacgttatttatg, ttgttttctatcgcgtattaaatgt, caaaataacgtggaaaagagct, tcttttgtggtcgtcactgc, attgagccttggtatggaaacct, ggatttggctcaggattgcc

Latest Tender Detail from export inspection council of india EIC for the tender for p35s probe , tnos probe , fmv probe , plant trnl probe , p35s f primer , p35s r primer , tnos f primer , tnos r primer , fmv f primer , fmv r primer , plant trnl f primer , plant trnl r primer, boq for purchase of oligos primer and probes, fam-caaagatggacccccacccacg-tamra, vic/hex-atgggtttttatgattagagtcccgcaa-tamra, vic-ctgacagcccactcactaatgc-tamra, fam-ttaattccagggtttctctgaatttgaaagtt-tamra, gcctctgccgacagtggt, aagacgtggttggaacgtcttc, catgtaatgcatgacgttatttatg, ttgttttctatcgcgtattaaatgt, caaaataacgtggaaaagagct, tcttttgtggtcgtcactgc, attgagccttggtatggaaacct, ggatttggctcaggattgcc in daskroi, gujarat,. Reference number 15523506. Don't miss out on this chance to be part of a significant project. Register for free today to access the complete tender details and download the necessary documents. Seize the opportunity with Tender 18!

T18 Ref No:15523506
Tender ID:GEM/2026/B/7586437
Tender Agency:export inspection council of india EIC
City:daskroi
State:gujarat
Description :total quantity = 24 ----- document required from seller = experience criteria,past performance,bidder turnover,certificate (requested in atc),oem authorization certificate,oem annual turnover,additional doc 1 (requested in atc),additional doc 2 (requested in atc),additional doc 3 (requested in atc),additional doc 4 (requested in atc),compliance of boq specification and supporting document
Tender Value:Refer Document
Tender EMD:Refer Document
Tender Fee:Refer Document
Published Date:May 26, 2026
Due Date:Jun 16, 2026
Tender Opening Date:Jun 16, 2026
Tender DocumentsDownload Document
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tender Inquiry